Processing
CRISPR-Cas12a (Cpf1) crRNA Oligo Entry
IDT RUO products are manufactured in accordance with ISO 9001 and are intended for research use only. For clarity, RUO products are not intended for human use, including any clinical or diagnostic applications. If you are interested in using IDT products for clinical applications, please contact IDT application support to learn more about alternative manufacturing services available at IDT.
Loading Page...
-
5' Dye 5' Code 3' Quencher 3' Code Other Show Other 5' Dyes Hide Other 5' Dyes
Base Notations
- RNA, expressed as 'r_', for example rA, rU.
- 2' O-methyl RNA bases are entered as 'm_'.
- Phosphorothioated RNA bases are entered as 'r_*'.
- Phosphorothioated 2'-O-methyl RNA bases are entered as 'm_*'.
Looking for controls?
NOTE:The same positive and negative controls can be used for both A.s. and L.b. Cas12a (Cpf1) nucleases.
To order, increase the # of items, then copy and paste the appropriate name and sequence from the following list into this ordering page:| Cas12a (Cpf1) positive control crRNAs | |
|---|---|
| Item Name: | Cas12a (Cpf1) Pos Ctrl crRNA, Human HPRT |
| Sequence: | GGTTAAAGATGGTTAAATGAT |
| Item Name: | Cas12a (Cpf1) Pos Ctrl crRNA, Mouse HPRT |
| Sequence: | GGATGTTAAGAGTCCCTATCT |
| Item Name: | Cas12a (Cpf1) Pos Ctrl crRNA, Rat HPRT |
| Sequence: | ATGCTTAAGAGGTATTTGTTA |
| Cas12a (Cpf1) negative control crRNAs | |
|---|---|
| Item Name: | Cas12a (Cpf1) Neg Ctrl crRNA #1 |
| Sequence: | CGTTAATCGCGTATAATACGG |
| Item Name: | Cas12a (Cpf1) Neg Ctrl crRNA #2 |
| Sequence: | CATATTGCGCGTATAGTCGCG |
| Item Name: | Cas12a (Cpf1) Neg Ctrl crRNA #3 |
| Sequence: | GGCGCGTATAGTCGCGCGTAT |
Did you know?
Batch editing
Edit scale, purification, normalization and services across multiple items simultaneously.Bulk Input
| Code | Scale |
|---|---|
| Code | Purification |
|---|---|
| Code | Modification |
|---|---|
Change All
Include reverse complement
Melting Temperature Settings
| Parameter sets | |
|
|
|
|
|
|
| Target type | |
| Oligo Conc | µM |
| Na+ Conc | mM |
| Mg++ Conc | mM |
| dNTPs Conc | mM |
+32 (0) 16 28 22 60
Contact us
PRODUCTS
SUPPORT
TOOLS
EDUCATION
© 2024 Integrated DNA Technologies, Inc.
Trademarks contained herein are the property of Integrated DNA Technologies, Inc. or their respective owners, and may be registered in the USA and/or other jurisdictions. For specific trademark information, see www.idtdna.com/trademarks.
For research use only. Not for use in diagnostic procedures. Unless otherwise agreed to in writing, IDT does not intend for these products to be used in clinical applications and does not warrant their fitness or suitability for any clinical diagnostic use. Purchaser is solely responsible for all decisions regarding the use of these products and any associated regulatory or legal obligations.
