CRISPR-Cpf1 genome editing

Expand your options for genome editing with the Alt-R™ CRISPR-Cpf1 System

The Alt-R CRISPR-Cpf1 System allows for new CRISPR target sites that are not available with the CRISPR-Cas9 System and produces a staggered cut with a 5′ overhang.

  • Enables genome editing in organisms with AT-rich genomes
  • Allows interrogation of additional genomic regions compared to Cas9
  • Requires simply complexing the crRNA with the Cpf1 protein—no tracrRNA needed
  • Permits efficient delivery of the RNP into cells by electroporation

We recommend using the Alt-R A.s. Cpf1 Nuclease 2NLS combined with the Alt-R CRISPR-Cpf1 crRNA to generate a ribonucleoprotein (RNP) editing complex. The Alt-R Cpf1 Electroporation Enhancer is critical for optimal delivery by electroporation and is recommended for all experiments using this transfection method. View the Alt-R™ CRISPR-Cpf1 System User Guide for guidance on electroporation and delivery of the RNP into your cell lines.

Unlike S. pyogenes Cas9, which cleaves most potential NGG PAM sites to some degree, some of the tested TTTV sites show no cleavage by A.s. Cpf1 nuclease. We recommend using positive control crRNAs (see below for suggested sequences) to establish that your cells can be edited by Cpf1. In addition, we recommend testing 3 or more crRNAs per target gene.  

CRISPR-Cpf1 crRNA

Customer-defined crRNA that will bind to 21–24 bases on the DNA strand that is opposite to the TTTV, PAM sequence. Prices shown are for each crRNA, and plates require a minimum order of 24 crRNAs. More info >
ProductPricingLength
Alt-RTM CRISPR-Cpf1 crRNA 2 nmol€ 90,00 EUR20 - 24 BasesOrder
Alt-RTM CRISPR-Cpf1 crRNA 10 nmol€ 115,00 EUR20 - 24 BasesOrder
ProductPricingLength96 Well384 Well
Alt-RTM Cpf1 crRNA, 2 nmol, Plate€ 75,00 EUR / well20 - 24 BasesOrderOrder
Alt-RTM Cpf1 crRNA, 10 nmol, Plate€ 100,00 EUR / well20 - 24 BasesOrderOrder

Note: Ordering information for the Alt-R™ Genome Editing Detection Kit is available here.

Heading

Positive control crRNAs

Positive control crRNAs can be used to show that Cpf1 editing is occurring in your experiments, which can be useful when you are optimizing RNP delivery conditions or if you need to troubleshoot your experiments.

IDT scientists have designed and tested positive control crRNAs targeting HPRT. To order, copy and paste the appropriate sequence in the Cpf1 crRNA ordering page:

Human HPRT1, Cpf1 Positive Control crRNA: GGTTAAAGATGGTTAAATGAT

Mouse Hprt, Cpf1 Positive Control crRNA: GGATGTTAAGAGTCCCTATCT

Rat Hprt1, Cpf1 Positive Control crRNA: ACCGCCCCCCCCATACCCCAA


Negative controls

Negative control crRNAs are important for showing that transfection of the RNP complex is not responsible for observed phenotypes. Amplification of DNA from these negative control samples with your experimental primers and cycling conditions should result in only full-length products with the Alt-R Genome Editing Detection Kit (i.e., in a T7EI assay). Note, that this result does not rule out off-target effects of your experimental crRNA.

IDT scientists have computationally designed and tested negative control crRNAs to be non-targeting in human, mouse, and rat genomes. To order, copy and paste the appropriate sequence in the Cpf1 crRNA ordering page:

Cpf1 Negative Control crRNA #1: CGTTAATCGCGTATAATACGG

Cpf1 Negative Control crRNA #2: CATATTGCGCGTATAGTCGCG

Cpf1 Negative Control crRNA #3: GGCGCGTATAGTCGCGCGTAT


CRISPR control PCR primers (HPRT)

These PCR primer mixes are for use with the Alt-R Genome Editing Detection Kit to detect editing or estimate editing efficiency in samples transfected with the Cpf1 Positive Control crRNAs. To order, use the following ordering menu:

Controls

Alt-R™ CRISPR-Cpf1 System

Simple, 2-step delivery of ribonucleoprotein complexes (crRNA:Cpf1)

Alt-R CRISPR-Cpf1 System using ribonucleoprotein electroporation

Figure 1. Overview of Alt-R™ CRISPR-Cpf1 System experiments for ribonucleoprotein (RNP) delivery by electroporation.



CRISPR-Cpf1 genome editing method uses the Cpf1 endonuclease to generate double-stranded breaks that contain a staggered 5′ overhang. Cpf1 only requires a single CRISPR RNA (crRNA) to specify the DNA target sequence (Figure 1). After cleavage, DNA is then repaired by non-homologous end-joining (NHEJ) or homology-directed recombination (HDR), resulting in a modified sequence. Alt-R CRISPR-Cpf1 reagents provide essential, optimized tools needed to use this pathway for genome editing research. A brief comparison of CRISPR-Cas9 and CRISPR-Cpf1 is provided at the end of this section.

Alt-R™ CRISPR-Cpf1 System
Required components
Alt-R™ CRISPR-Cpf1 crRNA Target-specific RNA oligo, custom synthesized based on your sequence
Alt-R™ A.s. Cpf1 Nuclease 2NLS • Protein that binds the Cpf1 crRNA, creating an experiment-ready, active ribonucleoprotein (RNP) complex
• Contains 2 nuclear localization signals (NLSs) for optimal performance
Alt-R™ Cpf1 Electroporation EnhancerCpf1-specific carrier DNA required for efficient electroporation of the RNP

Related reagents and kits
Cpf1 positive controls Order as custom crRNAs or oligos
• HPRT crRNAs (human, mouse, or rat): To show that Cpf1 editing is occurring in your system during experimental optimization or troubleshooting
• HPRT PCR primers (human, mouse, or rat): To detect genome editing in experiments with HPRT crRNAs; for use with the Alt-R Genome Editing Detection Kit
Alt-R™ Genome Editing Detection Kit For mutation detection and estimating editing efficiency

Components for genome editing

Cpf1 endonuclease from Acidaminococcus sp. BV3L6 along with a crRNA is capable of mediating genome editing in mammalian cells (Figure 2). The Alt-R CRISPR-Cpf1 System includes 3 main components: an optimized crRNA, A.s. Cpf1 endonuclease, and an electroporation enhancer. While electroporation of Cpf1 endonuclease as part of an RNP is the preferred method, the Alt-R CRISPR-Cpf1 crRNA is also compatible with A.s. Cpf1 from any source, including cells that stably express A.s. Cpf1 endonuclease.


CRISPR editing with Cpf1 protein and crRNA

Figure 2. Components of the Alt-R™ CRISPR-Cpf1 System for directing Cpf1 endonuclease to genomic targets. Alt-R Cpf1 crRNA forms a complex with Cpf1 endonuclease to guide targeted cleavage of genomic DNA. The cleavage site is specified by the protospacer element of the crRNA (thick green bar). The crRNA protospacer element recognizes 21 nt on the opposite strand of the TTTV PAM site. The PAM site must be present immediately upstream of the protospacer element for cleavage to occur. PAM = protospacer adjacent motif; V = A, C, or G

  • Alt-R CRISPR-Cpf1 crRNA and design tips

The Alt-R CRISPR-Cpf1 crRNA is a single, 40–44 base, guide RNA, comprised of a 20 base constant region (loop domain) and a 20–24 base target-specific region (protospacer domain). We typically recommend a 21 base protospacer domain for optimal activity. All Alt-R CRISPR-Cpf1 crRNAs are synthesized with proprietary chemical modifications, which protect the crRNA from degradation by cellular RNases and further improve on-target editing performance.

For crRNAs used with A.s. Cpf1, identify locations in your target region with the protospacer adjacent motif (PAM) sequence, TTTV, where V is A, C, or G. Your Alt-R CRISPR-Cpf1 crRNA will bind to the DNA strand opposite to the PAM sequence (Figure 2). Do not include the PAM sequence in your crRNA design. An example of a correct crRNA sequence is shown in Figure 3.

Once you enter your 20–24 base target sequence, 20 additional bases and the necessary modifications will automatically be added by the order entry system for a total of 40–44 RNA bases. These additional bases and modifications are necessary to create a complete Alt-R CRISPR-cpf1 crRNA. The system will also convert the final sequence to RNA—enter DNA bases only into the ordering tool (Figure 3).

Cpf1 crRNA Do's and Dont's for Ordering

Figure 3. How to enter your Cpf1 crRNA target sequence. Because the crRNA recognizes and binds 21 bases on the DNA strand opposite from the TTTV sequence of the PAM site, order your crRNA by entering the 20–24 bases downstream of the PAM site, in the forward orientation as shown. Enter only DNA bases into the order entry tool. If you are pasting your CRISPR target site from an online design tool, make sure you verify the correct strand orientation. Do not include the PAM site in your design. Common incorrect design examples are shown in red. PAM = protospacer adjacent motif; V = A, C, or G

  • Alt-R A.s. Cpf1 Nuclease 2NLS

Alt-R A.s. Cpf1 Nuclease 2NLS enzyme is a high purity, recombinant Acidaminococcus sp. Cpf1. The enzyme includes 1 N-terminal nuclear localization sequence (NLS) and 1 C-terminal NLSs, as well as 3 N-terminal FLAG tags and a C-terminal 6-His tag. The Cpf1 enzyme must be combined with a crRNA to produce a functional, target-specific editing complex. For the best editing, combine Alt-R A.s. Cpf1 Nuclease 2NLS enzyme with optimized Alt-R CRISPR-Cpf1 crRNA in equimolar amounts.

In contrast to Streptococcus pyogenes Cas9, which recognizes an NGG PAM sequence, the A.s. Cpf1 PAM sequence is TTTV, which permits targeting of DNA sequences in AT-rich regions of the genome.

Product specifications:

Alt-R™ A.s. Cpf1 Nuclease 2NLS 

  • Amount provided: 100 µg or 500 µg
  • Molecular weight: 157,900 g/mol
  • Concentration: 10 µg/µL in 50% glycerol, [63 µM]
  • Endotoxin tested: <2 EU/mg
  • Shipping conditions: dry ice
  • Storage conditions: –20°C
  • Alt-R Cpf1 Electroporation Enhancer

The Alt-R Cpf1 Electroporation Enhancer is a Cpf1-specific carrier DNA that is optimized to work with the Amaxa® Nucleofector® device (Lonza) and the Neon® Transfection System (Thermo Fisher) for increased transfection efficiency and therefore, increased genome editing efficiency.


Positive controls

  • crRNAs

Positive control crRNAs can be used to show that Cpf1 editing is occurring in your experiments, which can be useful when you are optimizing RNP delivery conditions or if you need to troubleshoot your experiments.

IDT scientists have designed and tested positive control crRNAs targeting HPRT. To order, copy and paste the appropriate sequence in the Cpf1 crRNA ordering page:

Human HPRT1, Cpf1 Positive Control crRNA: GGTTAAAGATGGTTAAATGAT

Mouse Hprt, Cpf1 Positive Control crRNA: GGATGTTAAGAGTCCCTATCT

Rat Hprt1, Cpf1 Positive Control crRNA: ACCGCCCCCCCCATACCCCAA

Attention: Unlike  S. pyogenes Cas9, which cleaves most potential NGG PAM sites to some degree, some of the tested TTTV sites show no cleavage by A.s. Cpf1 nuclease. We recommend using positive control crRNAs to establish that your cells can be edited by Cpf1. In addition, we suggest testing 3 or more crRNAs per target gene.


  • PCR primers

IDT scientists have also designed and tested PCR primers (Alt-R HPRT PCR Primer Mixes for human, mouse, or rat) for use with the Alt-R Genome Editing Detection Kit to detect editing or estimate editing efficiency in samples transfected with the positive control HPRT crRNAs.


Negative controls

Negative control crRNAs are important for showing that transfection of the RNP complex is not responsible for observed phenotypes. Amplification of DNA from these negative control samples with your experimental primers and cycling conditions should result in only full-length products with the Alt-R Genome Editing Detection Kit (i.e., in a T7EI assay). Note, that this result does not rule out off-target effects of your experimental crRNA.

IDT scientists have computationally designed and tested negative control crRNAs to be non-targeting in human, mouse, and rat genomes. To order, copy and paste the appropriate sequence in the Cpf1 crRNA ordering page:

Cpf1 Negative Control crRNA #1: CGTTAATCGCGTATAATACGG

Cpf1 Negative Control crRNA #2: CATATTGCGCGTATAGTCGCG

Cpf1 Negative Control crRNA #3: GGCGCGTATAGTCGCGCGTAT


Comparison of CRISPR genome editing using Cas9 vs. Cpf1


  Cas9 system Cpf1 system
Applications General genome editing • For species with AT-rich genomes
• For regions with limiting design space for use of the CRISPR-Cas9 system
Ribonucleoprotein components • crRNA
• tracrRNA
• Cas9 endonuclease
• crRNA
• Cpf1 endonuclease
crRNA • Native: 42 nt
• Alt-R: 35–36 nt (36 nt recommended)
• Native: 42–44 nt
• Alt-R: 40–44 nt (41 nt recommended)
tracrRNA • Native: 89 nt
• Alt-R: 67 nt
 (not applicable)
CRISPR enzyme • Class 2, Cas type II
• M.W.*: 163,700 g/mol
• Endonuclease domains: RuvC-like and HNH 
• Class 2, Cas type V
• M.W.*: 157,900 g/mol
• Endonuclease domain: RuvC-like only
Double-stranded DNA cleavage • Blunt ended cut 3 bases upstream of the protospacer sequence
• PAM site often destroyed during genome editing
• 5′ overhanging cut on the 5′ side of the protospacer sequence
• PAM site may be preserved after genome editing
PAM sequence NGG TTTV
Current recommendations for Alt-R™ RNP delivery • Lipid-mediated transfection
• Electroporation ± Alt-R™ enhancer 
• Microinjection
• Electroporation with Alt-R™ enhancer
• Microinjection

* Molecular weight of Alt-R™ nuclease
N = any base; V = A, C, or G


PAM sites for Cpf1 include TTTA, TTTC, and TTTG

Unlike S. pyogenes Cas9, which cleaves most NGG PAM sites to some degree, A.s. Cpf1 nuclease has a lower rate of cleavage for the Cpf1 PAM sequence. IDT scientists have found that crRNAs that have TTTA, TTTC, and TTTG PAM sequences are more likely to be functional compared to crRNAs that have TTTT as a PAM sequence.

We recommend using positive control crRNAs to establish that your cells can be edited by Cpf1. In addition, we suggest testing 3 or more crRNAs per target gene using TTTV (i.e., TTTA, TTTC, and TTTG) as your PAM site.

Cpf1 PAM site is TTTV (i.e., TTTA, TTTC, TTTG)

Figure 1. Maximize successful CRISPR-Cpf1 genome editing by using TTTA, TTTC, or TTTG as the PAM site. HEK-293 cells were transfected with ribonucleoprotein (RNP: Alt-R™ A.s. Cpf1 Nuclease 2 NLS complexed with Alt-R CRISPR-Cpf1 crRNA) as instructed in the Alt-R CRISPR-Cpf1 User Guide—RNP electroporation, Amaxa® Nucleofector® system (available at www.idtdna.com/CRISPR-Cpf1). TTTN sites from 6 genes were used to design 232 Alt-R CRISPR-Cpf1 crRNAs. Editing efficiency was determined 48 hr after electroporation using the Alt-R Genome Editing Detection Kit, which provides the major components required for T7EI endonuclease assays. PAM = protospacer adjacent motif (Cpf1 PAM sequence is TTTV, where V = A, C, or G); N = any base

The electroporation enhancer is required for efficient genome editing with the CRISPR-Cpf1 system

We have found that some of the Cpf1 PAM sequences are not active sites for genome editing. We recommend that you test 3 or more PAM sites in your region of interest and include the Alt-R™ Cpf1 Electroporation Enhancer for efficient genome editing. The enhancer is a non-targeting carrier DNA that shows no integration into the target site based on next generation sequencing experiments.

Alt-R CRISPR-Cpf1 Electroporation Enhancer is required for RNP electroporation

Figure 2. Alt-R™ Cpf1 Electroporation Enhancer is required for efficient CRISPR editing in ribonucleoprotein (RNP) electroporation experiments. HEK-293 cells were transfected with 5 µM RNP (Alt-R A.s. Cpf1 Nuclease 2 NLS complexed with Alt-R CRISPR-Cpf1 crRNA) as instructed in the Alt-R CRISPR-Cpf1 User Guide—RNP electroporation, Amaxa® Nucleofector® system (available at www.idtdna.com/CRISPR-Cpf1). 12 Cpf1 PAM sites in the HPRT gene were targeted by Alt-R CRISPR-Cpf1 crRNAs. The electroporation reactions contained either no (dark blue) or 3 µM (light blue) Alt-R Cpf1 Electroporation Enhancer. Editing efficiency was determined 48 hr after electroporation using the Alt-R Genome Editing Detection Kit, which provides the major components required for T7EI assays. PAM = protospacer adjacent motif (Cpf1 PAM sequence is TTTV); x-axis: numbers specify gene locations; S = sense strand; AS = antisense strand.

Optimizing Cpf1 crRNA length improves gene editing performance

Systematic variation of crRNA length led to the development of the Alt-R™ CRISPR-Cpf1 crRNA, which shows improved gene editing in mammalian cells. Overall, crRNAs containing 21 nt protospacers provided the highest editing efficiency at most target sites (Figure 3). On-target activity was drastically reduced when protospacer lengths shorter than 20 nt were used (data not shown).

CRISPR-Cpf1 crRNA with 21mer protospacer length provide optimal editing activity

Figure 3. crRNA with 21mer protospacer lengths provides optimal on-target genome editing. Varying lengths of crRNAs targeting HPRT were reverse transfected using Lipofectamine® RNAiMAX™ reagent (Thermo Fisher), into a HEK-293–Cpf1 cell line that stably expresses Acidaminococcus sp.Cpf1. Genomic DNA was isolated, and genome editing was measured using the Alt-R™ Genome Editing Detection Kit (T7EI assay) and Fragment Analyzer™ (Advanced Analytical).

Positive control: CRISPR editing (Human, mouse, or rat HPRT)

Confirm that your CRISPR editing conditions are working by using positive control crRNAs. The results from positive control experiments are important for research publications and provide useful information, should you need to troubleshoot your experiments. (Sequences for crRNAs that target HPRT in human, mouse, or rat are available through the Alt-R CRISPR-Cpf1 crRNA ordering tool.)

To monitor genome editing in your positive control samples, use the Alt-R Genome Editing Detection Kit and CRISPR Control Primer Mixes (human, mouse, or rat).

T7EI digestion of CRISPR-Cpf1 HPRT positive controls

Figure 4. Sample data from T7 endonuclease I (T7EI) assays of samples transfected with Cpf1 HPRT Positive Controls. Genomic DNA from CRISPR-Cpf1 edited human, mouse, and rat HPRT controls were PCR amplified, digested using T7EI, and run on the Fragment Analyzer™ system (Advanced Analytical Technologies, Inc.). Reference standard bands at 5000 bp (upper marker) and 35 bp (lower marker) are used to align the gel and analyze the results. Estimated band sizes for the cut and uncut positive control amplicons are listed in the table. Cell lines used were HEK-293 (human), Hepa1-6 (mouse), and RG2 (rat). PCR annealing temperatures for human and mouse primers is 67°C and for rat primers is 64°C.